rtRT-PCR for the detection of O/ME-SA/SA-2018 FMDV
This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus lineage O/ME-SA/SA-2018, as it is an emerging lineage in South Asia since 2018. The assay has been tested on 34 FMDV positive samples (including 12 SA-2018 samples) with a specificity of 91,7% (11/12 SA-2018 samples detected). The primers and probes are indicated hereafter:
|
Oligo name (final concentration) |
Sequence (5’-3’) |
Use |
|
SA2018_F3 (0.4 μM) |
ACAACACCACCAATCCAAC |
Forward Primer |
|
SA2018_P3 (0.3 μM) |
FAM-ACTCACCCGACTTGCACTGCCGT-TAMRA |
Probe |
|
SA2018_Rev2 (0.4 μM) |
CGTTGTAAACAGTAGCCATGA |
Reverse Primer |
The SA-2018 has been validated using Ag-Path kit in a duplex system with β-actin, and following the volumes and concentrations as follow (5 µl of RNA):
|
|
Volume (µl) |
Concentration |
||
|
|
For one tube |
Initial |
Final |
|
|
Ultrapure water (DNase RNase Free) |
1,15 |
/ |
||
|
Buffer 2X (kit AgPath-ID™) |
12,5 |
2 |
1 |
X |
|
Primer F |
1 |
10 |
0,4 |
µM |
|
Primer R |
1 |
10 |
0,4 |
µM |
|
Probe FAM-TAMRA |
0,75 |
10 |
0,3 |
µM |
|
Primer F β-actine |
1 |
10 |
0,4 |
µM |
|
Primer R β-actine |
1 |
10 |
0,4 |
µM |
|
Probe VIC-TAMRA β-actine |
0,6 |
5 |
0,12 |
µM |
|
RT-PCR mix 25X (Enzyme) |
1 |
25 |
1 |
X |
Real-time PCR program:
|
Cycles of RTq-PCR |
||
|
T° |
Time |
nb cycles |
|
45°C |
10min |
1 |
|
95°C |
10min |
1 |
|
95°C |
15s |
45 |
|
62°C |
1min |
|
NB: This system has been validated on a small number of samples and should therefore be tested against other samples from this lineage.