New rt RT-PCR for the detection of the SAT1/III FMDV (candidate assay)

In response to the emergence of SAT1/III in the Middle East and European Union between 2025 and 2026, the following real-time RT-PCR assay (SAT1/III “BOT/1/77 like”) has been tested on few samples from this topotype. Data from EURL from FMD indicate that this assay is able to detect viruses from the SAT/III clade that is actually present in EU and Middle East. At this stage, this is a candidate assay that has not been extensively validated and further work is underway at the EURL and WRL for FMD.

The primers and probes are indicated hereafter:

 

Oligo name

(final concentration)

Sequence (5’-3’)

Use

Position (VP1)

SAT1_III_2026_F (0.4 μM)

ACTCTGGTTGGGAAGACTACTG

Forward Primer

118-139

SAT1_III_2026_P (0.3 μM)

FAM-CATGGTTCTGGATCTTCTGAGCACCAA-TAMRA

Probe 

147-173

SAT1_III_2026_R (0.4 μM)

GGCGCCGACCAGTGACTT

Reverse Primer

178-195

 

The SAT1/III rtRT-PCR assay has been tested using Ag-Path kit in a duplex system with β-actin, and following the volumes and concentrations indicated in the methodology document that can be downloaded in the Methods section of the website.